Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03143

HP ID(1) HP03143
Gene ID(2) 6895
Gene Symbol finder TARBP2
Protein Name TAR (HIV-1) RNA binding protein 2
RefSeq NM_004178.4
Length of RefSeq (bp) 1448
Chromosome 12q12-q13
Reference DDBJ accession
UniGene Hs.326

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS083H07 pGCAP10 GAGCGTGCCCCGCGGCGGGCCCTACCGGCCGCGACTCCGGGCTTGGCCCCGGCCCTAGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl