Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03114

HP ID(1) HP03114
Gene ID(2) 8575
Gene Symbol finder PRKRA
Protein Name protein kinase, interferon-inducible double stranded RNA dependent activator
RefSeq NM_003690.3
Length of RefSeq (bp) 1835
Chromosome 2q31.2
Reference DDBJ accession
UniGene Hs.632540

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe89A12 pKA1U5 GGCGGGGGAGTCGGAGGAGGTGGCGGCGCTGGCCGCTCCTCCCGGGGACCAGCGTACCCG
ARi39B05 pGCAP10 GGGGGGAGTCGGAGGAGGTGGCGNNNCTGGNGCTCCTTCTCTNNACCNGCGACCNTAGNC
ARiS191A20 pGCAP10 GCTCGCTGGAGCAACGCAAGCAGGAGGCGGGGGAGTCGGAGGAGGTGGCGGCNCTGGAGC
RBd82F05 pGCAP10 GCCTCCCGGGGACCAGCGACCCGGGGAGCGAGCACGTCGCTCCGCACCGCTCTTCCTCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl