Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03069

HP ID(1) HP03069
Gene ID(2) 5550
Gene Symbol finder PREP
Protein Name prolyl endopeptidase
RefSeq NM_002726.3
Length of RefSeq (bp) 2849
Chromosome 6q22
Reference DDBJ accession
UniGene Hs.436564

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS051F08 pGCAP10 GGGGCCCGCCCGCCGGGGAGGGGCTCCCGGCCTCGCAGACAGCGGCTTCCTGCTTTCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl