Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP03041

HP ID(1) HP03041
Gene ID(2) 10440
Gene Symbol finder TIMM17A
Protein Name translocase of inner mitochondrial membrane 17 homolog A (yeast)
RefSeq NM_006335.2
Length of RefSeq (bp) 1675
Chromosome 1q32.1
Reference DDBJ accession
UniGene Hs.20716

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17A03 pGCAP10 GGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTGGATGACTG
ARi71H03 pGCAP10 GAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTGGATGACTGTG
ARiS096M18 pGCAP10 GACTCGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAAT
ARiS118D10 pGCAP10 GACTCGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAAT
RBd04G01 pGCAP10 GATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTGGATGA
RBd11E11 pGCAP10 GAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTGGATGACTGTG
RBd49G10 pGCAP10 GACTCGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAAT
RBd63C12 pGCAP10 GACTCGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAAT
RBdS022H23 pGCAP10 GATCACTCGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCG
RBdS051I22 pGCAP10 GGCGGCATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTG
RBdS081B20 pGCAP10 GATTGGAGTCAAGATGGAGGAGTACGCGCGAGAGCCTTGCCCATGGCGAATTGTGGATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl