Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02958

HP ID(1) HP02958
Gene ID(2) 7262
Gene Symbol finder PHLDA2
Protein Name pleckstrin homology-like domain, family A, member 2
RefSeq NM_003311.3
Length of RefSeq (bp) 937
Chromosome 11p15.5
Reference DDBJ accession
UniGene Hs.154036

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS020I21 pGCAP10 GAGAGCCGGCGCCGTCACCGCCCGCATTGCCGCTCCCAGTCCCGCGCTCGGCACGACATG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl