Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02951

HP ID(1) HP02951
Gene ID(2) 4668
Gene Symbol finder NAGA
Protein Name N-acetylgalactosaminidase, alpha-
RefSeq NM_000262.2
Length of RefSeq (bp) 3726
Chromosome 22q13-qter; 22q11
Reference DDBJ accession
UniGene Hs.75372

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42C03 pKA1U5 GAGAAGCGGCGGCAGGTCTGAACGCTTCGGTAGGATAAGTGCGGTGGGAGGGGGCTCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl