Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02801

HP ID(1) HP02801
Gene ID(2) 24148
Gene Symbol finder PRPF6
Protein Name PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
RefSeq NM_012469.3
Length of RefSeq (bp) 3120
Chromosome 20q13.33
Reference DDBJ accession
UniGene Hs.31334

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS075A07 pGCAP10 GAGAGTCTCTGCGTCTTTCCCTCTTCCGCTGCCTCATTCCTTTCCTTCCTAGCCTTGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl