Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02701

HP ID(1) HP02701
Gene ID(2) 5359
Gene Symbol finder PLSCR1
Protein Name phospholipid scramblase 1
RefSeq NM_021105.1
Length of RefSeq (bp) 2077
Chromosome 3q23
Reference DDBJ accession
UniGene Hs.130759

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31C03 pKA1U5 GAGACCCTTTTCCGGCTGACTTCTGAGAAGGTTGCGCAGCAGCTGTGCCCGGCAGTCTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl