Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02692

HP ID(1) HP02692
Gene ID(2) 57213
Gene Symbol finder C13orf1
Protein Name chromosome 13 open reading frame 1
RefSeq NM_020456.2
Length of RefSeq (bp) 3220
Chromosome 13q14
Reference DDBJ accession
UniGene Hs.44235

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe59B05 pKA1U5 GAGACGGAGCTGAGCGGCGGGGGGCAGTGTCGCCTCGGTCTAGGGACGGCGGCGGAGTCG
RBd35B11 pGCAP10 GAGTGTCGCCTCGGTCTAGGCACGGCGGCGGAGTCGGTGGTCCCTGCGCGATGGCCACCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl