Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02667

HP ID(1) HP02667
Gene ID(2) 6880
Gene Symbol finder TAF9
Protein Name TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 32kDa
RefSeq NM_003187.4
Length of RefSeq (bp) 1245
Chromosome 5q11.2-q13.1
Reference DDBJ accession
UniGene Hs.653163

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe14E10 pKA1U5 GGAAGCCGTCGCGGCGGGGACCATGTTGCTTCCGAACATCCTGCTCACCGGTACACCAGG
ARiS055I01 pGCAP10 GAGGTACGGCCTCCCGGGGACCTTCCAGACTGGTCGGCGCAAGCGAAGGGCGGGGACCAC
ARiS088M09 pGCAP10 GGGGGACCATGTTGCTTCCGAACATCCTGCTCACCGGTACACCAGGGGTTGGAAAAACCA
ARiS194K11 pGCAP10 GGCTTCCGNACATCCTGCTCACCGGTACACCAGGGGTTGGAAAAACCACACTAGGCAAAG
RBb41C10 pGCAP1 GGTCGCGGCGGGGACCATGNTTGCTTCCGAACATCCTGCTCACCGGTACACCAGGGGTTG
RBd05A05 pGCAP10 GGAAGCCGTCGCGGCGGGGACCATGTTGCTTCCGAACATCCTGCTCACCGGTACACCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl