Prev. | NRCD Clone J | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02643

HP ID(1) HP02643
Gene ID(2) 3727
Gene Symbol finder JUND
Protein Name jun D proto-oncogene
RefSeq NM_005354.4
Length of RefSeq (bp) 1890
Chromosome 19p13.2
Reference DDBJ accession
UniGene Hs.2780

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe83H05 pKA1U5 AGGAGCCGCCGCCAGTGGAGGGCCGGGCGCTGCGGCCGCGGCCGGGGCGGGCGCAGGGCC
RBb09G05 pKA1U5 GAGCCGCCGCCAGTGGAGGGCCGGGCGCTGCGCCCTCNGCCGGGGCGGGCGCAGGGCCGA
RBb13E05 pKA1U5 GGAGCCGCCGCCAGNTGGAGGGCCGGGCGCTGCCCCNTTNNNCCGGGGCGGGCGCAGGGT
RBb23A04 pGCAP1 GACTCCCCCCCGGGCCGGCGCGGCGGGGGAGGCGGAGGATGGAAACACCCTTCTACNGCG
RBd77B08 pGCAP10 CGGCCGGCCGATGGGAGCCGCCGCCAGTGGAGGGCCGGGCGCTGCGGCCGCGGCCGGGGC
RBdS051F07 pGCAP10 GAGGAGCCGCCGCCAGTGGAGGGCCGGGCGCTGCGGCCGCGGCCGGGGCGGGCGCAGGGC
RBdS177F08 pGCAP10 GAGGAGCCGCCGCCNGTGGAGGGCCGGGCGCTGCGGCCGCGGCCGGGGCGGGCGCAGGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl