Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02600

HP ID(1) HP02600
Gene ID(2) 10654
Gene Symbol finder PMVK
Protein Name phosphomevalonate kinase
RefSeq NM_006556.3
Length of RefSeq (bp) 1307
Chromosome 1q22
Reference DDBJ accession
UniGene Hs.30954

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd37G07 pGCAP10 GGGAGCTTCACGAGGGGAGGCTGCTCTGTGAAGGAACCGCCTTTCTCTCCGCGTGTCTCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl