Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02169

HP ID(1) HP02169
Gene ID(2) 26521
Gene Symbol finder TIMM8B
Protein Name translocase of inner mitochondrial membrane 8 homolog B (yeast)
RefSeq NM_012459.1
Length of RefSeq (bp) 423
Chromosome 11q23.1-q23.2
Reference DDBJ accession
UniGene Hs.279915

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe44H10 pKA1U5 GGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGATGAAGCGGAGTTGCAGC
ARe78H10 pKA1U5 GGTCGGAAGGTGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGATGAAGCG
RBd26G11 pGCAP10 GAAAACAGANTTTGGGGGTTGTTTGGGATTAATGAAGCTACTGCCTTTGCAACCCGATCA
RBd30H12 pGCAP10 GGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGATGAAGCGGAGTTGCAGC
RBd99D03 pGCAP10 CTTTAGAGCTGTCGGAAGGTGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCC
RBdS022E21 pGCAP10 GAGCTGTCGGAAGGTGGCGAGCCTGAGGCGAACAATGGCGGAGCTGGGCGAAGCCGATGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl