Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02140

HP ID(1) HP02140
Gene ID(2) 10544
Gene Symbol finder PROCR
Protein Name protein C receptor, endothelial (EPCR)
RefSeq NM_006404.3
Length of RefSeq (bp) 1483
Chromosome 20q11.2
Reference DDBJ accession
UniGene Hs.647450

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe97G06 pKA1U5 GCCCAGACTCCGCCCCTCCCAGACGGTCCTCACTTCTCTTTTCCCTAGACTGCAGCCAGC
ARi60B04 pGCAP10 GCTCTTTTCCCTAGACTGCAGCCAGCGGAGCCCGCAGCCGGCCCGAGCCAGGAACCCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl