Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02128

HP ID(1) HP02128
Gene ID(2) 56061
Gene Symbol finder UBFD1
Protein Name ubiquitin family domain containing 1
RefSeq NM_019116.2
Length of RefSeq (bp) 4931
Chromosome 16p12
Reference DDBJ accession
UniGene Hs.3459

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe34C08 pKA1U5 GGGGTGTTGTACACAATCATCATGGCGGCGGCCGGGGCCCCGGATGGCATGGAGGAACCT
RBdS022G12 pGCAP10 GGCCTCTGCGGGAGCGGTGGGTGTTGTACACAATCATCATGGCGGCGGCCGGGGCCCCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl