Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP02094

HP ID(1) HP02094
Gene ID(2) 84154
Gene Symbol finder BXDC1
Protein Name brix domain containing 1
RefSeq NM_032194.1
Length of RefSeq (bp) 1078
Chromosome 6q21
Reference DDBJ accession
UniGene Hs.372265

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa21D06 pKA1U5 GGAGGGCACGTGCATGCCCCCTGGTTAAGAGTTGCAGGTAGCGGTAGCGATGGAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl