Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01956

HP ID(1) HP01956
Gene ID(2) 51234
Gene Symbol finder TMEM85
Protein Name transmembrane protein 85
RefSeq NM_016454.2
Length of RefSeq (bp) 1013
Chromosome 15q14
Reference DDBJ accession
UniGene Hs.250905

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe77B09 pKA1U5 GAGAGTGAGACAAAGCGGAGAACGCTGGTGGGCCTGTTTGTGGAGTACGCTTTGGACTGA
ARi35H09 pGCAP10 GAGAGTGAGACCTTACGGATAACGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAA
RBd76G11 pGCAP10 GGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAGAAGCATCGAGGCTATAGGACGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl