Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01901

HP ID(1) HP01901
Gene ID(2) 9520
Gene Symbol finder NPEPPS
Protein Name aminopeptidase puromycin sensitive
RefSeq NM_006310.3
Length of RefSeq (bp) 4364
Chromosome 17q21
Reference DDBJ accession
UniGene Hs.443837

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb36F12 pGCAP1 GGTAGGCAGCTCGCCCGCCAGTCCGCCCGCACCGCCTCCTTCCCAACCCCTAGCGCTCCG
RBd68H02 pGCAP10 GACAGCCTGGGCCTCGCCGCGATGCCGGAGAAGAGGCCCTTCGAGCGGCTGCCTGCCGAT
RBdS007G03 pGCAP10 GTCCCCCGGTCGCTCTCCTCCGGCGGTCGCCCGCGCTCGGTGGATGTGGCTGGCAGCTGC
RBdS070G06 pGCAP10 GGCTCTCCTCCGGCGGTCGCCCGCGCTCGGTGGATGTGGCTGGCAGCTGCCGCCCCCTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl