Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01685

HP ID(1) HP01685
Gene ID(2) 7803
Gene Symbol finder PTP4A1
Protein Name protein tyrosine phosphatase type IVA, member 1
RefSeq NM_003463.3
Length of RefSeq (bp) 5099
Chromosome 6q12
Reference DDBJ accession
UniGene Hs.227777

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb17F08 pKA1U5 GGCCTCGGCGCGTGTATTGGCTCCTTCGGCTGCGGGCCGGCTCGGCTACGCGCTCTGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl