Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01653

HP ID(1) HP01653
Gene ID(2) 6888
Gene Symbol finder TALDO1
Protein Name transaldolase 1
RefSeq NM_006755.1
Length of RefSeq (bp) 1319
Chromosome 11p15.5-p15.4
Reference DDBJ accession
UniGene Hs.438678

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22A11 pKA1U5 GAGACCCCTCGGTCTTGCTATGTCGAGCTCACCCGTGAAGCGTCAGAGGATGGAGTCCGC
ARe34F01 pKA1U5 GCCCGTCGCCGCCGCCGCCGCCGCAGACCCCTCGGTTCTTGCTATGTCGAGCTCACCCGT
ARe35G09 pKA1U5 AGACCCCTCGGTCTTGCTATGTCGAGCTCACCCGCTGAAGCGTCAGAGGATGGAGTCCGC
ARiS045D06 pGCAP10 GACCCCTCGGTCTTGCTATGTCGAGCTCACCCGTGAAGCGTCAGAGGATGGAGTCCGCGC
ARiS088G09 pGCAP10 GAGACCCCTCGGTCTTGCTATGTCGAGCTCACCCGTGAAGCGTCAGAGGATGGAGTCCGC
RBb39G01 pGCAP1 GCCCGTCGCCGCCGCCGCCGCCGCAGACCCCTCGGTCTTGCTATGTCGAGCTCACCCGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl