Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01638

HP ID(1) HP01638
Gene ID(2) 51637
Gene Symbol finder C14orf166
Protein Name chromosome 14 open reading frame 166
RefSeq NM_016039.2
Length of RefSeq (bp) 1064
Chromosome 14q22.1
Reference DDBJ accession
UniGene Hs.534457

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi08A06 pGCAP10 GGCCCTCTCGCCGCGTCGCCGGTGCCTGCGCCTCCCGCTCCACCTCGCTTCTTCTCTCCC
ARi19F06 pGCAP10 GCTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATGTTCCG
ARi36G01 pGCAP10 GGTCGCCGGTGCCTGCGCCTCCCGCTCCACCTCGCTTCTTCTCTCCCGGCCGAGGCCCGG
ARiS008L09 pGCAP10 ACCTCGCTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATG
ARiS194B17 pGCAP10 TGGTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATGTTCCG
RBb37C08 pGCAP1 GGCCTGCGCCTCCCGCTCCACCTCGCTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGA
RBd15C05 pGCAP10 GGCTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATGTTCC
RBd70E10 pGCAP10 GTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATGTTCCGA
RBdS075L23 pGCAP10 GCTTCTTCTCTCCCGGCCGAGGCCCGGGGGACCAGAGCGAGAAGCGGGGACCATGTTCCG
RBdS187O14 pGCAP10 GCTCTCGCCGCGTCGCCGGTGCCTGCGCCTCCCGCTCCACCTCGCTTCTTCTCTCCCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl