Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01622

HP ID(1) HP01622
Gene ID(2) 6882
Gene Symbol finder TAF11
Protein Name TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28kDa
RefSeq NM_005643.2
Length of RefSeq (bp) 1599
Chromosome 6p21.31
Reference DDBJ accession
UniGene Hs.112444

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd67D05 pGCAP10 GAGCTCGGGTTTCCGAGCTTCTGCCTCAGGCATCTCCGCGATCTCCTCTCCCCTCCAATC
RBdS014D20 pGCAP10 GCCGCGATCTCCTCTCCCCTCCAATCCTATCCGTGATGGACGATGCCCACGAGTCGCCCT
RBdS070O16 pGCAP10 GCCCTCCAATCCTATCCGTGATGGACGATGCCCACGAGTCGCCCTCCGACAAAGGTGGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl