Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01599

HP ID(1) HP01599
Gene ID(2) 7045
Gene Symbol finder TGFBI
Protein Name transforming growth factor, beta-induced, 68kDa
RefSeq NM_000358.2
Length of RefSeq (bp) 2805
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.369397

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11D05 pKA1U5 TTACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTC
ARe16E01 pKA1U5 ATGACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGT
ARe23F03 pKA1U5 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARe32D02 pKA1U5 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTNGCTAGCTCGCTCGGTGCGCGTCG
ARe48F05 pKA1U5 GCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGCTCGGATCGCTAGCTCGCTCGGTGCGC
ARe51A09 pKA1U5 GCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTC
ARe66C07 pKA1U5 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARe70B07 pKA1U5 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARe73C03 pKA1U5 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTTCGNTAGCTCGCTCGGTGCGCGTC
ARe73F01 pKA1U5 GTCACTTCCCTGGAGCCGCCCGCATTGCCCGNTCGGCTCGCATAGCATCGCTCGGTGCGC
ARe87G10 pKA1U5 GACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCC
ARe89F07 pKA1U5 ACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCCC
ARi11H03 pGCAP10 CGGCCGGCCGATGAACCTGGCCCGGGCGGCGGAGGCGCTCTCACTTCCCTGGAGCCGCCC
ARi28H01 pGCAP10 CGGCCGGCCGATGACTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGC
ARi35D08 pGCAP10 GCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGT
ARi40D12 pGCAP10 CTCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTC
ARi54C07 pGCAP10 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARi54D08 pGCAP10 ACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCCC
ARi55A10 pGCAP10 GACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCC
ARi63A10 pGCAP10 GACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCC
ARi67C06 pGCAP10 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARi67D06 pGCAP10 GCCCCTTTCCCCNCGCCCGCTCGCTTGCTTCCTCCCTCTGCCTTCNTTCCCCAGCGCCGG
ARi69G07 pGCAP10 TGCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTC
ARiS045A20 pGCAP10 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARiS085G18 pGCAP10 TACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCGTCC
ARiS088P04 pGCAP10 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARiS118H13 pGCAP10 GCTCACTTCCCTGGAGCCGCCCGCTTGCCCGTCGGTCGCTAGCTCGCTCGGTGCGCGTCG
ARiS122P01 pGCAP10 ACTTAACCTGGCCCGGGCNNNGGANGCGCTCTCACTTCCCTGGAGCCGCCCGCTTGCCCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl