Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01495

HP ID(1) HP01495
Gene ID(2) 51027
Gene Symbol finder BOLA1
Protein Name bolA homolog 1 (E. coli)
RefSeq NM_016074.3
Length of RefSeq (bp) 872
Chromosome 1p36.13-q31.3
Reference DDBJ accession
UniGene Hs.13880

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi58G06 pGCAP10 GAGCGTGCCTCAGGAAGGGCGCCAGGACTGCATTTTGCTCCGGAGCGTCCAGAGTCCTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl