Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01261

HP ID(1) HP01261
Gene ID(2) 5828
Gene Symbol finder PXMP3
Protein Name peroxisomal membrane protein 3, 35kDa (Zellweger syndrome)
RefSeq NM_000318.2
Length of RefSeq (bp) 4392
Chromosome 8q21.1
Reference DDBJ accession
UniGene Hs.437966

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi09E03 pGCAP10 GCCGGAAGCCTTGGTAATCCAGATTCGGCTAGGAAAAGACAAGCTTTCCAGAGAATGTTT
RBb53D03 pGCAP1 GGTCGGCGTTTCGCGGTTGTTTGGCCATCCAGTGCCTTCCGCAGCGCCGCTAAAGCGCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl