Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01256

HP ID(1) HP01256
Gene ID(2) 9039
Gene Symbol finder UBA3
Protein Name ubiquitin-like modifier activating enzyme 3
RefSeq NM_003968.3
Length of RefSeq (bp) 2136
Chromosome 3p14.1
Reference DDBJ accession
UniGene Hs.154320

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi37D04 pGCAP10 GGAACAATATGGCGGATGGCGAGGAGCCGGAGAAGAAAAGAAGGAGAATAGAGGAGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl