Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP01154

HP ID(1) HP01154
Gene ID(2) 4666
Gene Symbol finder NACA
Protein Name nascent polypeptide-associated complex alpha subunit
RefSeq NM_005594.4
Length of RefSeq (bp) 1102
Chromosome 12q23-q24.1
Reference DDBJ accession
UniGene Hs.505735

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe25A04 pKA1U5 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
ARe27H05 pKA1U5 GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
ARe38A07 pKA1U5 GCTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAG
ARe45C03 pKA1U5 ATCCTGGCTTTCTGCCGCCATCTTGGTTCCGCGCTTCNCTGCACAAAATGCCCGGCGAAG
ARe50C10 pKA1U5 GCCCTGCACAGTAAGTACTTTCTGTGCCGCTACTGTCTATCCGCAGCCATCCGCCTTTCT
ARe50H08 pKA1U5 GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
ARe83G04 pKA1U5 GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
ARe91C12 pKA1U5 GCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTC
ARe93C05 pKA1U5 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
ARi17H07 pGCAP10 GCCCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCT
ARi27G11 pGCAP10 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
ARi33E12 pGCAP10 GCCCTGCACAGTAAGTACTTTCTGTGCCGCTACTGTCTATCCGCAGCCATCCGCCTTTCT
ARi37G09 pGCAP10 GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
ARi48G08 pGCAP10 TGGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
ARi61C09 pGCAP10 GCTTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACA
ARi63H08 pGCAP10 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAGCCTCCTTTTTATTCCCTTCCT
ARiS008D11 pGCAP10 GCTTTCTGCCGCCNTCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
ARiS008G14 pGCAP10 GCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
ARiS008I04 pGCAP10 GAGCCATCCGCCTTTCTTTCGGGCTAAGCCGCCCCGGGGACTGAGAGTTAAGGAGAGTTG
ARiS023F16 pGCAP10 GCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
ARiS055M19 pGCAP10 GCTTTTTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCA
ARiS161F20 pGCAP10 CGGCCGGCCGATGCCCCTCCGCTCCAGGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCT
ARiS191O12 pGCAP10 GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
ARiS194C09 pGCAP10 GCCCCTCCNCTCCANGCTTCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTT
RBb15G01 pKA1U5 GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
RBb21D04 pKA1U5 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
RBb34C11 pGCAP1 GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
RBb37D11 pGCAP1 GCCATCTTGGTTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGTAAACCGGTC
RBb50B10 pGCAP1 GGCCATCTTGGTTCCGCGGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCC
RBb58F09 pGCAP1 GCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCC
RBd21D01 pGCAP10 GATCCGCAGCCATCCGCCTTTCTTTCGGGCTAAGCCGCCCCGGGGACTGAGAGTTAAGGA
RBd32C05 pGCAP10 GCCTTCTGCAACAGGCGTGGGTCACGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTC
RBd45A02 pGCAP10 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
RBd50B01 pGCAP10 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
RBd63B11 pGCAP10 GGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCC
RBd95C12 pGCAP10 GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
RBd95D07 pGCAP10 GCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA
RBdS013A09 pGCAP10 GCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACC
RBdS022K16 pGCAP10 GATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGAAACCGTCCCTGC
RBdS075L03 pGCAP10 GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
RBdS081N02 pGCAP10 CGGCCGGCCGATGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCC
RBdS083O04 pGCAP10 GGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCAC
RBdS177L15 pGCAP10 GGCTCTCGCTCGGTCTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCG
RBdS187F05 pGCAP10 GCTTTCNNNCGCCATCTTGGTTCCGCGTTCCCTGCACAAAATGCCCGGCGAAGCCACAGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl