Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00944

HP ID(1) HP00944
Gene ID(2) 4702
Gene Symbol finder NDUFA8
Protein Name NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa
RefSeq NM_014222.2
Length of RefSeq (bp) 859
Chromosome 9q33.2-q34.11
Reference DDBJ accession
UniGene Hs.495039

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb24F02 pGCAP1 GACTCGGCGGTCGAAAGGGGAGTTCAAGGAGACGGGGGCGACGCGGCTGAGGGCTTCTCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl