Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00881

HP ID(1) HP00881
Gene ID(2) 5351
Gene Symbol finder PLOD1
Protein Name procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase 1
RefSeq NM_000302.2
Length of RefSeq (bp) 3004
Chromosome 1p36.3-p36.2
Reference DDBJ accession
UniGene Hs.75093

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS122B16 pGCAP10 GCTGCGAGCGCCGCCGGGTCGGCCGATCGTCCCCCATACCTCGGCCATGCGGCCCCTGCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl