Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00826

HP ID(1) HP00826
Gene ID(2) 5094
Gene Symbol finder PCBP2
Protein Name poly(rC) binding protein 2
RefSeq NM_005016.5
Length of RefSeq (bp) 3187
Chromosome 12q13.12-q13.13
Reference DDBJ accession
UniGene Hs.546271

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe01H03 pKA1U5 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCACCCTCATACCTGCGCCCTCTCCCACCTGA
ARe07A11 pKA1U5 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCCGNNNGN
ARe11A04 pKA1U5 TGGCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGCTCGCCTCGCGCCTGCAGTTTTTGGC
ARe18B04 pKA1U5 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCCGNANGT
ARe22G01 pKA1U5 GAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGTTAAGNTTT
ARe25G05 pKA1U5 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCANCCTGCGCCCTCTCCCGNTATGN
ARe49A02 pKA1U5 GGAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCCGNNNNGNA
ARe65D12 pKA1U5 GCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCCGNTNGTT
ARe66H08 pKA1U5 GAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCCGCCCGAATN
ARe97F04 pKA1U5 NCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTTCCGCCNGNN
ARi02B02 pGCAP10 GAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGC
ARi19A10 pGCAP10 GCTCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCG
ARi45B08 pGCAP10 TGAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCNCGCCCG
ARi66A07 pGCAP10 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGNNNN
ARi67F10 pGCAP10 GAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGA
ARi69H11 pGCAP10 GCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCAC
ARiS088M11 pGCAP10 GCCCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTTGGCTT
RBb02B10 pKA1U5
RBb20H03 pKA1U5 GGCCCCCGGCCTCCCGCCCTTCCCCTTCCCGCCCGCTTCCCCTTTTCCCCTCAGTCGCCT
RBb38H02 pGCAP1
RBb46A08 pGCAP1 NCCCAGAACCAGCAGANGCAGCAGCCGGANGCAGCCGCAGCCTGCGCCCTTCTCCCGTNT
RBb49F04 pGCAP1 CCCTTCCCGCCCGCTCCCCTTTTCCCCTCAGTCGCCTCGCGCCTGCAGTTTTTGGCTTTC
RBb66B07 pGCAP1 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGAA
RBb68E07 pGCAP1 GCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGTTT
RBd72E02 pGCAP10 GCCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCC
RBd73F11 pGCAP10 GAGACCNNCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCCCGCCCGC
RBdS014O17 pGCAP10 GAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGNCNNNNAAA
RBdS015H02 pGCAP10 GCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGCNNNANT
RBdS075N02 pGCAP10 GCCAGACCAGCAGAGGCAGCAGCCGGAGCAGCCGCAGCCTGCGCCCTCTCCCGNNNGNNG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl