Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00773

HP ID(1) HP00773
Gene ID(2) 7009
Gene Symbol finder TMBIM6
Protein Name transmembrane BAX inhibitor motif containing 6
RefSeq NM_003217.2
Length of RefSeq (bp) 2885
Chromosome 12q12-q13
Reference DDBJ accession
UniGene Hs.708025

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe22F11 pKA1U5 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
ARe44H09 pKA1U5 TGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTGG
ARe62G10 pKA1U5 GGTCAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGA
ARe80F11 pKA1U5 ATCCTGGAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGA
ARi06G10 pGCAP10 CGGCCGGCCGATGAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGG
ARi10E08 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
ARi42H12 pGCAP10 TGAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGT
ARi45G04 pGCAP10 GCAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGT
ARi48F07 pGCAP10 CGGCCGGCCGATTGATTTTTCCTTAAAATTTGGACTTGTACAGTAAGGACTTCAACTGAC
ARi53D03 pGCAP10 CGGCCGGCCGATGGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGG
ARi66A03 pGCAP10 GGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTGGAGACTGCTGCACG
ARi68B05 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
ARiS013A14 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
ARiS013C21 pGCAP10 GGTCNNANCNCATCNNNNNTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGA
ARiS023C24 pGCAP10 AGCAGANCNCNTCNGGTGTTAGAANNGCTGGNANGNCNNGNAGAGGCGGGTTAGGAANAG
ARiS045L05 pGCAP10 TGATCGAAAGATCAACTTTGATGCGCTTTTAAAATTTTCTCATATAACCCCGTCAACGCA
ARiS194E24 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
ARiS198L23 pGCAP10
RBb13E03 pKA1U5 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCCTTGGAGAGGCGGGTTAGGAAGAGT
RBd06B06 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
RBd52E09 pGCAP10 GAGAGCACATCCGGTGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
RBd87H11 pGCAP10 GGGTGGATGGGTGGGAAGGCCTTGGAGAGGCGGGTTAGGAAGAGTGGAGACTGCTGCACG
RBdS083E09 pGCAP10 GAGAGCNCATCCGGTGTTAGAANCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTG
RBdS154C04 pGCAP10 GGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTGGAGACTGCTGCACG
RBdS187O09 pGCAP10 GGTTAGAAGCGCTGGTAGGCCTTGGAGAGGCGGGTTAGGAAGAGTGGAGACTGCTGCACG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl