Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00770

HP ID(1) HP00770
Gene ID(2) 5527
Gene Symbol finder PPP2R5C
Protein Name protein phosphatase 2, regulatory subunit B', gamma isoform
RefSeq NM_002719.2
Length of RefSeq (bp) 4167
Chromosome 14q32
Reference DDBJ accession
UniGene Hs.368264

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi46D08 pGCAP10 GGTCTTTTTTTTTTTAAACTAAAATGGAGGCTGGTTTCTTGCCTTAAGGAGCCCATTGCC
ARi64A01 pGCAP10 GTTNTCTNTNNNTTAACTAAATGANGCTGNTTTCTNNNNTNNNANCCATTGCTTCCGCTG
RBd46H04 pGCAP10 GGTCTTTTTTTTTTTAAACTAAAATGGAGGCTGGTTTCTTGCCTTAAGGAGCCCATTGCC
RBd91G01 pGCAP10 GAGTTCCCTCCAGCTGCAGAGAGCTTCAGTTTGTCTTTTTTTTTTAAACTAAAATGGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl