Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00600

HP ID(1) HP00600
Gene ID(2) 10450
Gene Symbol finder PPIE
Protein Name peptidylprolyl isomerase E (cyclophilin E)
RefSeq NM_006112.2
Length of RefSeq (bp) 1307
Chromosome 1p32
Reference DDBJ accession
UniGene Hs.524690

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe95B06 pKA1U5 GGGAAAAGCGCGCGAGCAAGATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGACTGG
RBb45H11 pGCAP1 GGGAAAAGCGCGCGAGCAAGATGGCCACCACCAAGCGCGTCTTGTACGTGGGTGGACTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl