Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00559

HP ID(1) HP00559
Gene ID(2) 7280
Gene Symbol finder TUBB2A
Protein Name tubulin, beta 2A
RefSeq NM_001069.2
Length of RefSeq (bp) 1621
Chromosome 6p25
Reference DDBJ accession
UniGene Hs.654543

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42E05 pKA1U5 GAGGTCTCTGCGCAGCCCAGCCCGCCGGTCCACGCCGCGCACCGCTCCGAGGGCCAGCGC
ARi07H10 pGCAP10 GAGGTCTCTGCGCAGCCCAGCCCGCCGGTCCACGCCGCGCACCGCTCCGAGGGCCAGCGC
ARiS109P18 pGCAP10 AGGTCTCTGCGCAGCCCAGCCCGCCGGTCCACGCCGCGCACCGCTCCGAGGGCCAGCGCC
RBb32D05 pGCAP1 GCTCAGCCCGTCGGTTCCCGAGCGCCTTCCCGGTGACCCCGCAGTGGGTGTGTGAGGGGA
RBd21E07 pGCAP10 GCTCAGCAGCCAGCCCGGCCCGCCCGCGCCCGTCCGCAGCCGCCCGCCAGACGCGCCCAG
RBd25A09 pGCAP10 GGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCT
RBd28G05 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd30C06 pGCAP10 GGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl