Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00549

HP ID(1) HP00549
Gene ID(2) 203068
Gene Symbol finder TUBB
Protein Name tubulin, beta
RefSeq NM_178014.2
Length of RefSeq (bp) 2510
Chromosome 6p21.33
Reference DDBJ accession
UniGene Hs.636480

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04H05 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARe07B05 pKA1U5 TTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCATCTGGGGCGCATTCCAACCTTC
ARe13A07 pKA1U5 ATCCTGGTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCG
ARe20A10 pKA1U5 TGCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATT
ARe34B08 pKA1U5 GGCCCAGCCTGCTTTCCCTCCGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCT
ARe43B05 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARe47E12 pKA1U5 CCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGCTTTGCACCTCGCTGCTCCAGCCTCT
ARe62D09 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARe67F03 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARe90F07 pKA1U5 ATCCTGCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGG
ARf06C01 pKA1U5 GCTTTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTC
ARi04G11 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARi20G12 pGCAP10 GCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTC
ARi22F11 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARi27G07 pGCAP10 GCTTTTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCT
ARi29D12 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
ARi32D10 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARi34E07 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
ARi35D03 pGCAP10 GAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAA
ARi35H06 pGCAP10 TGCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTT
ARi51F08 pGCAP10 TAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAA
ARi52C01 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARi65B01 pGCAP10 GACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCT
ARiS008A23 pGCAP10 GGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTG
ARiS008P11 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARiS013P19 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
ARiS020O11 pGCAP10 TGGCCCAGCCTGCTTTCCCTCCGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCC
ARiS049J15 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
ARiS049L19 pGCAP10 GAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACC
ARiS085N21 pGCAP10 TGGCTCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
ARiS085O12 pGCAP10 GCTCTCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
ARiS109I08 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARiS191P05 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
ARiS194G03 pGCAP10 TGAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCA
ARiS194H13 pGCAP10 TGAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCA
ARiS198F15 pGCAP10 GCTCTCANAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGNNCNT
RBb04B05 pKA1U5 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBb09G10 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBb11A01 pKA1U5 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBb24B03 pGCAP1 GCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGC
RBb25G11 pGCAP1 GGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTG
RBb30B02 pGCAP1 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBb31F08 pGCAP1 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBb33F11 pGCAP1 TTGCCCTCTCAGAACCTTCCTGCCGTTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGG
RBb34B03 pGCAP1 GCTTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCC
RBb34C03 pGCAP1 GCTTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTTCGCGTTTGCACCTCGCTGCTCCAGC
RBb35F06 pGCAP1 AATGTGTGGGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTNNAACCTTCCAGCCTGCGA
RBb36G12 pGCAP1 CCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAA
RBb37G01 pGCAP1
RBb44C11 pGCAP1 TTTTCTCCCTCTCAGAACCTTNCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTG
RBb46H09 pGCAP1 ACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAA
RBb47A05 pGCAP1 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBb47E03 pGCAP1 TGAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCA
RBb56B03 pGCAP1 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBb65B03 pGCAP1 GCCCGCCTCCCAGCCCCGGCGCACGCGCGCCCCGCCCAGCCTGCTTTCCCTCCGCGCCCT
RBb71A10 pGCAP1 GCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCT
RBb72A06 pGCAP1 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBb72B08 pGCAP1 GTGCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGC
RBb72E10 pGCAP1 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd06C01 pGCAP10 CGGCCGGCCGATGCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAG
RBd08D05 pGCAP10 TGCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGC
RBd08E05 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBd10H10 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd11G11 pGCAP10 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBd14F08 pGCAP10 GCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCC
RBd22E10 pGCAP10
RBd31B12 pGCAP10 TGAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGAGAAAAAAAATTACT
RBd32A03 pGCAP10 GCTCCNTCTCGGAACCTTCCTGCAGTCGCGTTTGCCCCTCCAAGCTCCAGCCTCGNNNGC
RBd32A04 pGCAP10 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBd39F03 pGCAP10 GCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTC
RBd40A08 pGCAP10 GCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCT
RBd43C09 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd46B12 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBd46C08 pGCAP10 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBd50C08 pGCAP10 GCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTC
RBd51G08 pGCAP10 GCTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGG
RBd57B08 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCNGCCTCTGGGGCGCAT
RBd59A05 pGCAP10 GCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCA
RBd62F09 pGCAP10 GCTCAGACCCCCAGCCTTTTGTGCGCCGCGCGGTGGGGCGGTGCCCAGCTTGGGGGAAGG
RBd63H03 pGCAP10 GTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGG
RBd70E04 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd76F10 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBd79F11 pGCAP10 GACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCT
RBd82E06 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBd82H09 pGCAP10 GCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCT
RBd84G03 pGCAP10 GCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCA
RBd85D08 pGCAP10 TGGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGC
RBd92A09 pGCAP10 GAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAA
RBd92G06 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBd96H07 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBd98F03 pGCAP10 GCCTTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTC
RBd98F11 pGCAP10 GGCGTTTGCACCTCGGTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBdS007K23 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS007O14 pGCAP10 AGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBdS013A05 pGCAP10 GCTTTTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCT
RBdS013D04 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS015E15 pGCAP10 TGAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCA
RBdS015I20 pGCAP10 GCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCT
RBdS040H03 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBdS051G19 pGCAP10 GGCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGG
RBdS075F15 pGCAP10 GCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCA
RBdS083I15 pGCAP10 GGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGA
RBdS104B13 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS105I12 pGCAP10 GGCGCCCTCCCCTCTCCTTTCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCG
RBdS110J01 pGCAP10 GGCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCA
RBdS110L01 pGCAP10 TGCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCG
RBdS132G02 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS132J15 pGCAP10 GGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACCTGCGGA
RBdS156C17 pGCAP10 GGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCCTGCGACC
RBdS177A05 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS177B17 pGCAP10 TGCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCA
RBdS177G16 pGCAP10 ANAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAAC
RBdS177J01 pGCAP10 TGGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAACCTTCCAGCC
RBdS177O16 pGCAP10 GCTCCCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGC
RBdS177O21 pGCAP10 GCTCTCAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCAT
RBdS187G05 pGCAP10 GAGAACCTTCCTGCCGTCGCGTTTGCACCTCGCTGCTCCAGCCTCTGGGGCGCATTCCAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl