Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00547

HP ID(1) HP00547
Gene ID(2) 9352
Gene Symbol finder TXNL1
Protein Name thioredoxin-like 1
RefSeq NM_004786.1
Length of RefSeq (bp) 1285
Chromosome 18q21.31
Reference DDBJ accession
UniGene Hs.114412

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe70F05 pKA1U5 GGGCACTGAGAGTCCCGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGG
ARe82B08 pKA1U5 GCTCCCCGCCCCCTCGGCCGCTCCGCTCCCTGGCGTGACTCGGCACTGAGAGTCCCGGGA
ARe97G11 pKA1U5 GACTGAGAGTCCCGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGGCCT
ARi40C10 pGCAP10 GGAGAGTCCCGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGGCCTTCC
RBd19G08 pGCAP10 GGGGAGGACCAAGATGGAGCGAAGGATGAAGTAGCAAGTGTACGTCTTTCTTGGGAGCAG
RBd41E11 pGCAP10 GCCCTCGGCCGCTCCGCTCCCTGGCGTGACTCGGCACTGAGAGTCCCGGGAGAAGACTCG
RBdS132A07 pGCAP10 GACTGAGAGTCCCGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGGCCT
RBdS156C10 pGCAP10 GGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGGCCTTCCTGAGTATCT
RBdS177F03 pGCAP10 GACTGAGAGTCCCGGGAGAAGACTCGGCGGTCGCCACCTCTTCTGTCCAGGCCTCGGCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl