Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00515

HP ID(1) HP00515
Gene ID(2) 4809
Gene Symbol finder NHP2L1
Protein Name NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae)
RefSeq NM_005008.2
Length of RefSeq (bp) 1601
Chromosome 22q13.2-q13.31
Reference DDBJ accession
UniGene Hs.182255

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66F10 pKA1U5 GCCTTGCGGTGCTGGGCAGCAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTGTC
ARf02E05 pKA1U5 GGTCCTTGCGGTGCTGGGCAGCAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTG
ARi20D06 pGCAP10 GGCTTGCGGTGCTGGGCAGCAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTGTC
ARi28F09 pGCAP10 GGCGGTGCTGGGCAGCAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTGTCCGGC
ARiS150F15 pGCAP10 GGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCCCTT
RBb43F03 pGCAP1 AGGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCC
RBd84F08 pGCAP10 GCCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAA
RBdS015C04 pGCAP10 GGCTTCCTGCCGCGCGGGGCCATTTCCGCTGCTGCTTCTGTGAGTTTTTCCGGTGCACGC
RBdS015D11 pGCAP10 GCCTAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAG
RBdS075N08 pGCAP10 GCCTTGCGGTGCTGGGCAGCAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTGTC
RBdS081N13 pGCAP10 GAGACCGTCCAAACCGACACGCGTGGTATCCTCGCGGTGTCCGGCAAGAGACTACCAAGA
RBdS083F10 pGCAP10 GGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCC
RBdS177H24 pGCAP10 GGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCCTATCCC
RBdS177I24 pGCAP10 GAGGAGTGCTGAGCCCGCGGAACCGCAGCCATGACTGAGGCTGATGTGAATCCAAAGGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl