Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00296

HP ID(1) HP00296
Gene ID(2) 6950
Gene Symbol finder TCP1
Protein Name t-complex 1
RefSeq NM_030752.2
Length of RefSeq (bp) 2463
Chromosome 6q25.3-q26
Reference DDBJ accession
UniGene Hs.363137

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04A11 pKA1U5 GAGTAGCTCCNGGGACATCGCNCGGGTACGCTNCCACGCCGTCNCANCCACNGCTCGTGG
ARe33C04 pKA1U5 GCTTCCCGCCGNGCCCCGCGGCCGGGCCGGGGCATNNNGGAAGCGGGTGGGGTGGTGTGT
ARe40G04 pKA1U5 GCTTCCCGCCGNTGCCCCGCGGCCGGGCCGGGGCNCCNGGAAAGCGGGTGGGGTGGTGTG
ARi27B01 pGCAP10 GCCTTCCCGCCGTGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTG
RBb17A11 pKA1U5 GGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCAGAATTC
RBb32C05 pGCAP1 GGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTCGCCGGTCGGCCG
RBd08B06 pGCAP10 GAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTC
RBd12H05 pGCAP10 GACTGCTGTGGTCGCCGGTCGGCCGAGGGGCCGCGATACTGGTTGCCCGCGGTGTAAGCA
RBd38F01 pGCAP10 TGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGCTCCTGGGACATCGCTCG
RBd60E02 pGCAP10 GGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGC
RBd60F10 pGCAP10 GGCCCCGCGGCCGGGCCGGGGCAGCCGGGAAGCGGGTGGGGTGGTGTGTTACCCAGTAGC
RBdS015G05 pGCAP10 GAGTAGCTCCTGGGACATCGCTCGGGTACGCTCCACGCCGTCGCAGCCACTGCTGTGGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl