Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00100

HP ID(1) HP00100
Gene ID(2) 9168
Gene Symbol finder TMSB10?
Protein Name thymosin, beta 10
RefSeq NM_021103.3
Length of RefSeq (bp) 482
Chromosome 2p11.2
Reference DDBJ accession
UniGene Hs.446574

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe02F03 pKA1U5 GGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACNTNGAATCTCGGGCTCGGAACGAG
ARe13C01 pKA1U5 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe14A10 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe14D11 pKA1U5 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGTATCTCGGGCTCGGAACGAGAC
ARe19G12 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCANTTATCTCGGGCTCGGAACGAGACT
ARe23H05 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe26H07 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe30G04 pKA1U5 TGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe31A07 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe32H07 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCNTTTATCTCGGGCTCGGAACGAGACT
ARe34D01 pKA1U5 TGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe38F10 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe39B10 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe44G05 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGNTATCTCGGGCTCGGAACGAGACT
ARe45E12 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGNATCTCGGGCTCGGAACGAGACTG
ARe49E04 pKA1U5 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe52C05 pKA1U5 TGGTTTTGTTTCTTGCTGCAACAACGCGAGATGNCCAGCANCACGATCTCGGGCTCGGAA
ARe53B08 pKA1U5 TGGTTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACG
ARe54A07 pKA1U5 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe55E11 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCNTTTATCTCGGGCTCGGAACGAGACT
ARe57A03 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe57C05 pKA1U5 GgttTctTGCTgcagcaaCNTCNTAGTTGGGANCACCATTTATCTCGGGCTCGGAACGAGA
ARe57E05 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe62A01 pKA1U5 GGTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAG
ARe64G08 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe69G10 pKA1U5 ATCCTGGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACG
ARe72F03 pKA1U5 ATCCTGGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACG
ARe72H10 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCCTTTATCTCGGGCTCGGAACGAGACT
ARe73B09 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGNATCTCGGGCTCGGAACGAGACTG
ARe74A04 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe75D06 pKA1U5 GGTTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCNGGTATCTCGGGCTCGGAACGAGA
ARe78D09 pKA1U5 TTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe79F10 pKA1U5 GTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTGC
ARe81D04 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe82B12 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe84E08 pKA1U5 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe87E12 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe88B04 pKA1U5 ATCCTGGGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGA
ARe89A01 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe92C11 pKA1U5 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARe93A11 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARe95G12 pKA1U5 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARf01H01 pKA1U5 TGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCATGTATCTCGGGCTCGGAACGAGAC
ARf02E03 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARf03A02 pKA1U5 GGTTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGAC
ARf05D03 pKA1U5 GGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGA
ARf07B02 pKA1U5 GCCCTGCTGCGGCGGGTGAGGGGCGGGGCGGGGCGCGGCGTATATAAGGCTAGGGGCGGG
ARf07H02 pKA1U5 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi04A03 pGCAP10 TGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi04A09 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi04H02 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi06B03 pGCAP10 CGGCCGGCCGATGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTC
ARi06F06 pGCAP10 CGGCCGGCCGATATGTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGG
ARi08F07 pGCAP10 CGGCCGGCCGATGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTC
ARi09H07 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi12B02 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi12B10 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi13F08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi18F03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi22C01 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi22D04 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi26B08 pGCAP10 GGTTTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACG
ARi26E11 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi27F08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi31F02 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi33D06 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi50C11 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi56E07 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi57C01 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi59B10 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi59F06 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARi60H03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi61A03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi62C01 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARi66G07 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS013D23 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS013L05 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS013L09 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS020F19 pGCAP10 GGTTTCTTGCTGCAGCCNCGCGAGTGGGANCACNNNGATCTCGGGCTCGGAACNANACTG
ARiS020M19 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS020P19 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS023C21 pGCAP10 GGTTNNNTGCTGCAGCNACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS023C23 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGNNCACCAGGATCTCGGGCTCGGAACNAGACTG
ARiS045B23 pGCAP10
ARiS045L23 pGCAP10 GGTTTCTTGCTGCNNCNACNCTAGTGGGANCNCCAGGATCTCGGGCTCGGAACGAGACTG
ARiS045M06 pGCAP10 GTGTTTCTTGCTGCAGCAACNCNAGTGGGAGCACCAGGATCTCGGGCTCGGAACNANACT
ARiS049J10 pGCAP10 AAAAGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAG
ARiS049K07 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS055A03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS055I16 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS055L23 pGCAP10
ARiS055N05 pGCAP10 GGTTTCTTGCTGCATCANCNTTAATGGGANCACCAGGATCTCGGGCTCGGAACGANACTG
ARiS085G13 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS085M19 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS085N01 pGCAP10 GGTTTCTNGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS087E16 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS087I15 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS088F17 pGCAP10 GGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGA
ARiS088K03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS096A23 pGCAP10 GGTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS096G08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS096J06 pGCAP10 TGGTTTCTTGCTGCAGCAACGCGAGTGGGANCACCNGGATCTCGGGCTCGGAACGAGACT
ARiS109D21 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS109I19 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS118F11 pGCAP10
ARiS118G05 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS118J10 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS122G22 pGCAP10 CGGCCGGCCGATTGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCT
ARiS122O14 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS150K16 pGCAP10 TGTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGAC
ARiS150L13 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS150M23 pGCAP10 GTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTGC
ARiS161L14 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS161M16 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS161O16 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS191G15 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS191P06 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS194C18 pGCAP10 GGTTTCTTGCTGCANCAACNCNAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
ARiS194F07 pGCAP10 TGGGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGA
ARiS194I02 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
ARiS198A03 pGCAP10 TGGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAG
ARiS198N24 pGCAP10 GGTTGTTTCTTGCTGCAGCAACGCGAGNGGGAGCCCCAGGANCTCGGGCTCGGAACGAG
ARiS198O07 pGCAP10 GGGGACGCGCCCAGATCCTCGGCCTTGGGGCTGCTCGGCACGCCTTGGCGCGAGTGCCAC
RBb19H07 pKA1U5 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCATTTATCTCGGGCTCGGAACGAGAC
RBb24D01 pGCAP1 TGTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGAC
RBb31G04 pGCAP1 TGGGTTTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGTATCTCGGGCTCGGA
RBb35D03 pGCAP1 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBb35H01 pGCAP1 TGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBb49D03 pGCAP1 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGNGCTCGGAACGAGACT
RBb64H10 pGCAP1
RBb68F06 pGCAP1 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBd11C01 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBd11C03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd16F11 pGCAP10 GGCGGCGTATATAAGGCTAGGGGCGGGCGCCGCTCTTTTGTTTCTTGCTGCAGCAACGCG
RBd16H02 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd20B07 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBd21B06 pGCAP10 GGTTTTTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAAC
RBd22G02 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGANGAGACTGC
RBd32A05 pGCAP10 GGTTTTTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGA
RBd37D08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd40D07 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd43G04 pGCAP10 GTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBd77G06 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd85F10 pGCAP10 GTGTTTCTTGCTGCCNCAACNCCAGNGGGAGCACCTNNATCTCGGGCTCNNAACGANACT
RBd96E04 pGCAP10 GGTTGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGA
RBd98H11 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBd99G01 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS007D20 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS007L21 pGCAP10 TGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBdS007N16 pGCAP10 TTGGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGAC
RBdS014B21 pGCAP10 GGTTTTTTTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAAC
RBdS015L08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS051I13 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS081C19 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS081H09 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT
RBdS083M03 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS104C08 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS156B02 pGCAP10 GGTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACTG
RBdS187N18 pGCAP10 GGTTTTCTTGCTGCAGCAACGCGAGTGGGAGCACCAGGATCTCGGGCTCGGAACGAGACT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl