Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP00059

HP ID(1) HP00059
Gene ID(2) 6897
Gene Symbol finder TARS
Protein Name threonyl-tRNA synthetase
RefSeq NM_152295.3
Length of RefSeq (bp) 2850
Chromosome 5p13.2
Reference DDBJ accession
UniGene Hs.481860

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22F12 pGCAP10 GGCCAAGTCCCGGGCGCTAGCCCACCTCCGACCCGCCTCTTGGCTCCTCTCCTCTAGGCC
ARi43C12 pGCAP10 ACCTCCGACCCGCCTCTTGGCTCCTCTCCTCTAGGCCGTCGCTTTCGGGTTCTCTCATCG
ARiS088H03 pGCAP10 GGAGGCCAAGTCCCCGGCGCTAGCCCACCTCCCACCCGCCTCTTGGCTCCTCTCCTCTAG
ARiS122J18 pGCAP10 GACCCGCCTCTTGGCTCCTCTCCTCTAGGCCGTCGCTTTCGGGTTCTCTCATCGCTTCGT
ARiS122N06 pGCAP10 GACCCGCCTCTTGGCTCCTCTCCTCTAGGCCGTCGCTTTCGGGTTCTCTCATCGCTTCGT
RBd62E07 pGCAP10 GATCAGCTGGTCCAGCCGAGGCCAAGTCCCGGGCGCTAGCCCACCTCCCACCCGCCTCTT
RBdS007M10 pGCAP10 TGGTGAAGTCCCGGGCGCTAGCCCACCTCCCACCCGCCTCTTGGCTCCTCTCCTCTAGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl