Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARiS198C12

Ordering information ordering information
Catalog Number HKR279260
Clone Name ARiS198C12
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human RAB35 (upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GAGCCGCAGCCTGAGCCGGCCGCGCCCGGGCCGCGCACGCGCCCTGACGGAGTCCCAGCA
Sequence, submitted(2) AB371568 link 01
 
HP ID HP11125  finder other clones in this HP group.
Sequence, refered AK130486.1
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

  DDBJ/EMBL/GenBank

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl