ARiS088A21 - NRCD Human cDNA Clone

This clone has been withdrawn.

Catalog Number HKR235221 Clone Name ARiS088A21 Clone info. Plasmid clone of human SPTBN1 cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GAGTCCCTCCCTCGGCCGCCTCTCCTCCCGGAGCGAGCGCGCAGCCCTGCGCAGCAGCGC Sequence, submitted(3) AB371586 [link]   Sequence, refered NM_003128.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) SPTBN1 (NCBI Gene 6711)  other clone of SPTBN1 in our bank Synonyms DDISBA|ELF|HEL102|SPTB2|betaSpII Protein Name spectrin beta, non-erythrocytic 1

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Restriction map is not available.

References and tips

Featured content

Reference

2023.06.06