Prev. |  Human A to Z list >   >   > 

ARiS020M24 - NRCD Human cDNA Clone

Catalog Number HKR208312
Clone Name ARiS020M24
Clone info. Plasmid clone of human BAG2 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GCCACTCGCTGCCGCCGGAGGGGCCGGTGACCTCTTGGCTACCCCGCGTCGGAGGCTTAG
Sequence, submitted(2) n.a.
Note 100% match to NM_004282.4 (314-1755) CDS:full
 
Sequence, refered NM_004282.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3)  (NCBI Gene 9532)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR208312 ARiS020M24 DNA solution

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(by primer A)
Seq File
(by primer B)
Seq File
(by primer C)
Seq File
(contig)
PDF File
ARiS020M24a.seq   ARiS020M24c.seq ARiS020M24z.seq ARiS020M24.pdf

References and tips

Featured content

Reference


2021.04.21

NRCDhumcloneList_AR_210404.csv - DataSheet_NRCD_html_200831.pl