Prev. |  Human A to Z list >  R >  RNU6-6P > 

ARiS020G07 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR208151
Clone Name ARiS020G07
Clone info. Plasmid clone of human RNU6-2 cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGC
Sequence, submitted(2) AB371443 [link]
 
Sequence, refered NR_002752.1 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RNU6-6P (NCBI Gene 26826)  other clone of RNU6-6P in our bank
Synonyms RNU6-6|RNU6B|U6-6
Protein Name RNA, U6 small nuclear 6, pseudogene
KEGG hsa:26826
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR208151 ARiS020G07 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.05.24

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_180123.pl