Prev. |  Human A to Z list >  A >  ARSA > 

ARiS019G20 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR207764
Clone Name ARiS019G20
Clone info. Plasmid clone of human ARSA cDNA with SV40 promoter
Vector Click for information pGCAP10
5'-terminal sequence(1) GGGAAGCGCCCGCAGCCCGGTACCGGCTCCTCCTGGGCTCCCTCTAGCGCCTTCCCCCCG
Sequence, submitted(2) AB448736 [link]
 
Sequence, refered NM_000487.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ARSA (NCBI Gene 410)  other clone of ARSA in our bank
Synonyms MLD
Protein Name arylsulfatase A
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR207764 ARiS019G20 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.11.21

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_181121.pl