Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARi35B11

Ordering information ordering information
Catalog Number HKR174035
Clone Name ARi35B11
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human RNASEH1(upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GGGCGCCCGGCACCCACGTGCGGTAACCGCGGCTCCTCGAGAGCTCCAGGGATGCGGATC
Sequence, submitted(2) AB371461 link 01
 
HP ID HP07729  finder other clones in this HP group.
Sequence, refered AK023018.1
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

  DDBJ/EMBL/GenBank

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl