Prev. |  Human A to Z list >  A >  ASPM > 

ARi25D04 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR170076
Clone Name ARi25D04
Clone info. Plasmid clone of human ASPM cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGGCTCCTCTTTTTAATTTGCGAGTTTATTGGGCTTGTTTTCNGTTTTCTAGGGAGTAGG
Sequence, submitted(2) n.a.
Note This clone is expected to contain 50-911nt of NM_018136.4 (cds 258-10691nt). Partial cds.
 
Sequence, refered NM_018136.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) ASPM (NCBI Gene 259266) finder other clone of ASPM in our bank
Synonyms ASP|Calmbp1|MCPH5
Protein Name asp (abnormal spindle) homolog, microcephaly associated (Drosophila)
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR170076 ARi25D04 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2017.10.27

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_171016.pl