Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARi20G04

Ordering information ordering information
Catalog Number HKR168148
Clone Name ARi20G04
Vector plasmidClick for information pGCAP10
Description Plasmid clone of human C20orf111(upstream, opposite) cDNA with SV40 promoter
5'-terminal sequence(1) GACAGTAGTCCTCTGCCTCCACCGCCCCGGGATCTCCTTGCGCTCGGTCCTCTACGTGGA
Sequence, submitted(2) AB371454 link 01
 
HP ID HP07079  finder other clones in this HP group.
Sequence, refered BC048277.1
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

  DDBJ/EMBL/GenBank

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl