Prev. |  Human A to Z list >  A >  ARHGAP29  > 

NRCD Human cDNA Clone - ARi10H07

Ordering information ordering information
Catalog Number HKR164175
Clone Name ARi10H07
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GGGTGGTGGTGCCTGTGGCTGTGGCTGCGGCTGCGGCTGCGGCTGAGATTTGGCCGGGCG
Sequence, submitted(2) Not available.
Description Plasmid clone of human ARHGAP29 cDNA with SV40 promoter
 
HP ID HP04312  finder other clones in this HP group.
Sequence, refered (NCBI RefSeq mRNA) NM_004815.3
Gene ID 9411
Gene Symbol ARHGAP29   finder other clones with this gene.
Protein Name Rho GTPase activating protein 29
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

Full length sequence and restriction map are not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.


2014.10.09

J:\Perl_src_\csv_set\NRCDhumcloneList_AR_140225.csv - GNP_filter3_NRCD_html_140904.pl