ARi03F09 - NRCD Human cDNA Clone

Catalog Number HKR161329 Clone Name ARi03F09 Clone info. Plasmid clone of human CDC123 cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GGGGAAAGGCAGCAGCGGCGGCAGCTGGAGGATGAAGAAGGAGCATGTGCTTCACTGCCA Sequence, submitted(3) n.a.   Sequence, refered NM_006023.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) CDC123 (NCBI Gene 8872)  other clone of CDC123 in our bank Synonyms C10orf7|D123 Protein Name cell division cycle 123

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

2023.05.02